CLI Reference

Auto-generated: All command output below is captured live during documentation build from the actual sirnaforge CLI.

This reference shows each command with its real --help output and working examples.

Help & Version

Main Help

                                                                               
 Usage: sirnaforge [OPTIONS] COMMAND [ARGS]...                                 
                                                                               
 siRNAforge - siRNA design toolkit for gene silencing                          
                                                                               
β”Œβ”€ Options ───────────────────────────────────────────────────────────────────┐
β”‚ --install-completion          Install completion for the current shell.     β”‚
β”‚ --show-completion             Show completion for the current shell, to     β”‚
β”‚                               copy it or customize the installation.        β”‚
β”‚ --help                        Show this message and exit.                   β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
β”Œβ”€ Commands ──────────────────────────────────────────────────────────────────┐
β”‚ search      Search transcript references and optionally fetch sequences.    β”‚
β”‚ workflow    Run the end-to-end workflow: transcripts β†’ siRNA design β†’       β”‚
β”‚             off-target.                                                     β”‚
β”‚ offtarget   Run off-target analysis on pre-designed siRNA candidates.       β”‚
β”‚ design      Design siRNA candidates from a transcript FASTA file.           β”‚
β”‚ validate    Validate a FASTA file and report basic statistics.              β”‚
β”‚ version     Show CLI version and author information.                        β”‚
β”‚ config      Print the default design parameter values.                      β”‚
β”‚ cache       Inspect and clear the unified reference cache.                  β”‚
β”‚ sequences   Manage siRNA sequences and metadata                             β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

Version

β”Œβ”€β”€β”€β”€β”€β”€β”€ Version Info ───────┐
β”‚ 🧬 siRNAforge Toolkit      β”‚
β”‚ Version: 0.4.1             β”‚
β”‚ Author: Austin S. Hovland. β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

workflow

Run complete siRNA design from gene query to scored candidates.

Help

                                                                               
 Usage: sirnaforge workflow [OPTIONS] GENE_QUERY                               
                                                                               
 Run the end-to-end workflow: transcripts β†’ siRNA design β†’ off-target.         
                                                                               
 This is the main orchestration command. It resolves transcriptome and miRNA   
 reference policies, designs candidates, and then runs off-target analysis on  
 the selected top candidates.                                                  
                                                                               
β”Œβ”€ Arguments ─────────────────────────────────────────────────────────────────┐
β”‚ *    gene_query      TEXT  Gene name or ID to analyze [required]            β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
β”Œβ”€ Options ───────────────────────────────────────────────────────────────────┐
β”‚ --input-fasta                            TEXT             Local path or     β”‚
β”‚                                                           remote URI to an  β”‚
β”‚                                                           input FASTA file  β”‚
β”‚                                                           (http/https/ftp)  β”‚
β”‚ --output-dir      -o                     PATH             Output directory  β”‚
β”‚                                                           for all workflow  β”‚
β”‚                                                           results           β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           sirna_workflow_o… β”‚
β”‚ --database        -d                     TEXT             Database to       β”‚
β”‚                                                           search (ensembl,  β”‚
β”‚                                                           refseq, gencode)  β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           ensembl]          β”‚
β”‚ --design-mode                            TEXT             Design mode:      β”‚
β”‚                                                           sirna (default)   β”‚
β”‚                                                           or mirna          β”‚
β”‚                                                           (miRNA-biogenesi… β”‚
β”‚                                                           [default: sirna]  β”‚
β”‚ --top-n           -n                     INTEGER RANGE    Number of top     β”‚
β”‚                                          [x>=1]           siRNA candidates  β”‚
β”‚                                                           to select (also   β”‚
β”‚                                                           used for          β”‚
β”‚                                                           off-target        β”‚
β”‚                                                           analysis)         β”‚
β”‚                                                           [default: 100]    β”‚
β”‚ --species                                TEXT             Comma-separated   β”‚
β”‚                                                           canonical species β”‚
β”‚                                                           identifiers. This β”‚
β”‚                                                           single parameter  β”‚
β”‚                                                           drives all        β”‚
β”‚                                                           off-target        β”‚
β”‚                                                           analysis: miRNA   β”‚
β”‚                                                           database lookups  β”‚
β”‚                                                           (default: 7       β”‚
β”‚                                                           species) and      β”‚
β”‚                                                           transcriptome     β”‚
β”‚                                                           fetching from     β”‚
β”‚                                                           Ensembl (default: β”‚
β”‚                                                           4 species).       β”‚
β”‚                                                           Override specific β”‚
β”‚                                                           layers with       β”‚
β”‚                                                           --mirna-species   β”‚
β”‚                                                           or                β”‚
β”‚                                                           --transcriptome-… β”‚
β”‚                                                           Supported: human, β”‚
β”‚                                                           mouse, macaque,   β”‚
β”‚                                                           rat, chicken,     β”‚
β”‚                                                           pig, rhesus       β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           chicken,pig,rat,… β”‚
β”‚ --mirna-db                               TEXT             miRNA reference   β”‚
β”‚                                                           database to use   β”‚
β”‚                                                           for seed analysis β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           mirgenedb]        β”‚
β”‚ --mirna-species                          TEXT             Override miRNA    β”‚
β”‚                                                           species           β”‚
β”‚                                                           identifiers       β”‚
β”‚                                                           (comma-separated… β”‚
β”‚                                                           When omitted,     β”‚
β”‚                                                           automatically     β”‚
β”‚                                                           maps from         β”‚
β”‚                                                           --species. Use    β”‚
β”‚                                                           this for surgical β”‚
β”‚                                                           control of miRNA  β”‚
β”‚                                                           database queries. β”‚
β”‚ --transcriptome…                         TEXT             Override or       β”‚
β”‚                                                           extend            β”‚
β”‚                                                           transcriptome     β”‚
β”‚                                                           references for    β”‚
β”‚                                                           off-target        β”‚
β”‚                                                           analysis.         β”‚
β”‚                                                           Accepts: local    β”‚
β”‚                                                           file, HTTP(S)     β”‚
β”‚                                                           URL, or           β”‚
β”‚                                                           pre-configured    β”‚
β”‚                                                           source (e.g.,     β”‚
β”‚                                                           'ensembl_human_c… β”‚
β”‚                                                           When omitted,     β”‚
β”‚                                                           automatically     β”‚
β”‚                                                           fetches Ensembl   β”‚
β”‚                                                           cDNA for species  β”‚
β”‚                                                           selected via      β”‚
β”‚                                                           --species. Custom β”‚
β”‚                                                           FASTA files are   β”‚
β”‚                                                           cached and        β”‚
β”‚                                                           indexed           β”‚
β”‚                                                           automatically.    β”‚
β”‚                                                           Use this to add   β”‚
β”‚                                                           novel sequences   β”‚
β”‚                                                           (e.g., synthetic  β”‚
β”‚                                                           contigs) to the   β”‚
β”‚                                                           default set.      β”‚
β”‚ --transcriptome…                         TEXT             Filter            β”‚
β”‚                                                           transcriptome to  β”‚
β”‚                                                           reduce size and   β”‚
β”‚                                                           memory            β”‚
β”‚                                                           requirements.     β”‚
β”‚                                                           Comma-separated   β”‚
β”‚                                                           filter names:     β”‚
β”‚                                                           'protein_coding'  β”‚
β”‚                                                           (only             β”‚
β”‚                                                           protein-coding    β”‚
β”‚                                                           genes),           β”‚
β”‚                                                           'canonical_only'  β”‚
β”‚                                                           (only canonical   β”‚
β”‚                                                           isoforms).        β”‚
β”‚                                                           Example:          β”‚
β”‚                                                           --transcriptome-… β”‚
β”‚                                                           protein_coding,c… β”‚
β”‚                                                           Filtered versions β”‚
β”‚                                                           are cached        β”‚
β”‚                                                           separately with   β”‚
β”‚                                                           automatic         β”‚
β”‚                                                           indexing.         β”‚
β”‚ --offtarget-ind…                         TEXT             Comma-separated   β”‚
β”‚                                                           overrides for     β”‚
β”‚                                                           genome indices    β”‚
β”‚                                                           used in           β”‚
β”‚                                                           off-target        β”‚
β”‚                                                           analysis. Format: β”‚
β”‚                                                           human:/abs/path/… β”‚
β”‚                                                           When provided,    β”‚
β”‚                                                           overrides         β”‚
β”‚                                                           cached/default    β”‚
β”‚                                                           genome            β”‚
β”‚                                                           references.       β”‚
β”‚ --gc-min                                 FLOAT RANGE      Minimum GC        β”‚
β”‚                                          [0.0<=x<=100.0]  content           β”‚
β”‚                                                           percentage        β”‚
β”‚                                                           [default: 30.0]   β”‚
β”‚ --gc-max                                 FLOAT RANGE      Maximum GC        β”‚
β”‚                                          [0.0<=x<=100.0]  content           β”‚
β”‚                                                           percentage        β”‚
β”‚                                                           [default: 60.0]   β”‚
β”‚ --length          -l                     INTEGER RANGE    siRNA length in   β”‚
β”‚                                          [19<=x<=23]      nucleotides       β”‚
β”‚                                                           [default: 21]     β”‚
β”‚ --modifications   -m                     TEXT             Chemical          β”‚
β”‚                                                           modification      β”‚
β”‚                                                           pattern           β”‚
β”‚                                                           (standard_2ome,   β”‚
β”‚                                                           minimal_terminal, β”‚
β”‚                                                           maximal_stabilit… β”‚
β”‚                                                           none)             β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           standard_2ome]    β”‚
β”‚ --overhang                               TEXT             Overhang sequence β”‚
β”‚                                                           (dTdT for DNA, UU β”‚
β”‚                                                           for RNA)          β”‚
β”‚                                                           [default: dTdT]   β”‚
β”‚ --skip-off-targ…                                          Skip off-target   β”‚
β”‚                                                           analysis (faster) β”‚
β”‚ --snp                                    TEXT             Variant           β”‚
β”‚                                                           identifier(s) for β”‚
β”‚                                                           SNP               β”‚
β”‚                                                           targeting/avoida… β”‚
β”‚                                                           Accepts rsID      β”‚
β”‚                                                           (rs12345),        β”‚
β”‚                                                           coordinate        β”‚
β”‚                                                           (chr17:7577121:G… β”‚
β”‚                                                           or HGVS           β”‚
β”‚                                                           (NM_000546.6:c.2… β”‚
β”‚                                                           Can be specified  β”‚
β”‚                                                           multiple times.   β”‚
β”‚                                                           All variants must β”‚
β”‚                                                           be on GRCh38      β”‚
β”‚                                                           assembly.         β”‚
β”‚ --snp-file                               PATH             VCF file          β”‚
β”‚                                                           containing        β”‚
β”‚                                                           variants for      β”‚
β”‚                                                           targeting/avoida… β”‚
β”‚                                                           Preferably        β”‚
β”‚                                                           bgzip-compressed  β”‚
β”‚                                                           with tabix index  β”‚
β”‚                                                           (.vcf.gz + .tbi)  β”‚
β”‚                                                           for performance.  β”‚
β”‚                                                           Variants are      β”‚
β”‚                                                           filtered by       β”‚
β”‚                                                           --min-af and      β”‚
β”‚                                                           --clinvar-filter… β”‚
β”‚ --variant-mode                           [target|avoid|b  How to handle     β”‚
β”‚                                          oth]             variants in siRNA β”‚
β”‚                                                           design: 'avoid' = β”‚
β”‚                                                           exclude           β”‚
β”‚                                                           candidates        β”‚
β”‚                                                           overlapping       β”‚
β”‚                                                           variants          β”‚
β”‚                                                           (default),        β”‚
β”‚                                                           'target' = design β”‚
β”‚                                                           siRNAs            β”‚
β”‚                                                           specifically      β”‚
β”‚                                                           targeting variant β”‚
β”‚                                                           alleles, 'both' = β”‚
β”‚                                                           generate          β”‚
β”‚                                                           candidates for    β”‚
β”‚                                                           both reference    β”‚
β”‚                                                           and alternate     β”‚
β”‚                                                           alleles.          β”‚
β”‚                                                           [default: avoid]  β”‚
β”‚ --min-af                                 FLOAT RANGE      Minimum allele    β”‚
β”‚                                          [0.0<=x<=1.0]    frequency         β”‚
β”‚                                                           threshold for     β”‚
β”‚                                                           variant           β”‚
β”‚                                                           inclusion.        β”‚
β”‚                                                           Variants with AF  β”‚
β”‚                                                           below this value  β”‚
β”‚                                                           are excluded      β”‚
β”‚                                                           (default: 0.01 =  β”‚
β”‚                                                           1%%).             β”‚
β”‚                                                           [default: 0.01]   β”‚
β”‚ --clinvar-filte…                         TEXT             Comma-separated   β”‚
β”‚                                                           ClinVar clinical  β”‚
β”‚                                                           significance      β”‚
β”‚                                                           levels to         β”‚
β”‚                                                           include. Default: β”‚
β”‚                                                           'Pathogenic,Like… β”‚
β”‚                                                           pathogenic'.      β”‚
β”‚                                                           Other options:    β”‚
β”‚                                                           'Benign', 'Likely β”‚
β”‚                                                           benign',          β”‚
β”‚                                                           'Uncertain        β”‚
β”‚                                                           significance'.    β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           Pathogenic,Likely β”‚
β”‚                                                           pathogenic]       β”‚
β”‚ --variant-assem…                         TEXT             Reference genome  β”‚
β”‚                                                           assembly for      β”‚
β”‚                                                           variants (only    β”‚
β”‚                                                           GRCh38 supported) β”‚
β”‚                                                           [default: GRCh38] β”‚
β”‚ --verbose         -v                                      Enable verbose    β”‚
β”‚                                                           output            β”‚
β”‚ --log-file                               PATH             Path to           β”‚
β”‚                                                           centralized log   β”‚
β”‚                                                           file (overrides   β”‚
β”‚                                                           SIRNAFORGE_LOG_F… β”‚
β”‚                                                           env)              β”‚
β”‚ --nextflow-dock…                         TEXT             Override the      β”‚
β”‚                                                           Docker image      β”‚
β”‚                                                           passed to         β”‚
β”‚                                                           Nextflow          β”‚
β”‚                                                           (default:         β”‚
β”‚                                                           ghcr.io/austin-s… β”‚
β”‚                                                           [env var:         β”‚
β”‚                                                           SIRNAFORGE_NEXTF… β”‚
β”‚ --json-summary        --no-json-summ…                     Write             β”‚
β”‚                                                           logs/workflow_su… β”‚
β”‚                                                           (disable to skip  β”‚
β”‚                                                           JSON output)      β”‚
β”‚                                                           [default:         β”‚
β”‚                                                           json-summary]     β”‚
β”‚ --help                                                    Show this message β”‚
β”‚                                                           and exit.         β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

Note

The workflow command searches for gene transcripts, designs siRNA candidates, scores them using thermodynamic analysis, and outputs ranked results.

Input Sources & Transcriptome References

siRNAforge accepts complementary inputs when you need to bypass gene search or control the reference used for transcriptome off-target analysis:

  • --input-fasta replaces the transcript retrieval step. Point it at a local FASTA file, HTTP(S) URL, or FTP location. The positional argument (GENE_QUERY) still names the outputs, while the workflow designs guides from the supplied sequences. When you pass --input-fasta without --transcriptome-fasta, transcriptome off-target analysis is disabled (design-only mode).

  • --transcriptome-fasta selects the dataset used for transcriptome off-target analysis. It accepts local paths, remote URLs, or presets such as ensembl_human_cdna and ensembl_mouse_cdna (see sirnaforge cache --info). Provide this flag to re-enable transcriptome off-target analysis when running from a custom FASTA.

  • --offtarget-indices overrides the genome indices used for Nextflow/BWA-MEM2 with explicit species:/path/to/index_prefix entries. When present, these drive the set of species processed by the off-target pipeline.

Passing both flags is common: the input FASTA feeds the design engine, while the transcriptome FASTA controls which reference is indexed for the Nextflow stage. Remote resources are cached under ~/.cache/sirnaforge/ and reused automatically.

Rows inside off_target/results/*/analysis.tsv and the aggregated combined_offtargets.tsv include a species column so you can filter hits directly. Aggregated summaries collapse those values into human vs other buckets, exposing hits_per_species, human_hits, and other_species_hits in combined_summary.json plus the workflow console output. The workflow also records the resolved reference decision in logs/workflow_summary.json (reference_summary.transcriptome) so each run documents whether the transcriptome reference was disabled, defaulted, or explicitly provided.



design

Design siRNA candidates from FASTA sequences.

Help

                                                                               
 Usage: sirnaforge design [OPTIONS] INPUT_FILE                                 
                                                                               
 Design siRNA candidates from a transcript FASTA file.                         
                                                                               
 Outputs a TSV/CSV-like table of candidates, optionally including secondary    
 structure scoring, off-target checks, and chemical modification annotations.  
                                                                               
β”Œβ”€ Arguments ─────────────────────────────────────────────────────────────────┐
β”‚ *    input_file      FILE  Input FASTA file containing transcript sequences β”‚
β”‚                            [required]                                       β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
β”Œβ”€ Options ───────────────────────────────────────────────────────────────────┐
β”‚ --output            -o      PATH                    Output file for siRNA   β”‚
β”‚                                                     candidates              β”‚
β”‚                                                     [default:               β”‚
β”‚                                                     sirna_results.tsv]      β”‚
β”‚ --design-mode               TEXT                    Design mode: sirna      β”‚
β”‚                                                     (default) or mirna      β”‚
β”‚                                                     (miRNA-biogenesis-awar… β”‚
β”‚                                                     [default: sirna]        β”‚
β”‚ --length            -l      INTEGER RANGE           siRNA length in         β”‚
β”‚                             [19<=x<=23]             nucleotides             β”‚
β”‚                                                     [default: 21]           β”‚
β”‚ --top-n             -n      INTEGER RANGE [x>=1]    Number of top-ranked    β”‚
β”‚                                                     candidates to select    β”‚
β”‚                                                     for                     β”‚
β”‚                                                     reporting/off-target    β”‚
β”‚                                                     (all candidates are     β”‚
β”‚                                                     still generated)        β”‚
β”‚                                                     [default: 100]          β”‚
β”‚ --gc-min                    FLOAT RANGE             Minimum GC content      β”‚
β”‚                             [0.0<=x<=100.0]         percentage              β”‚
β”‚                                                     [default: 30.0]         β”‚
β”‚ --gc-max                    FLOAT RANGE             Maximum GC content      β”‚
β”‚                             [0.0<=x<=100.0]         percentage              β”‚
β”‚                                                     [default: 60.0]         β”‚
β”‚ --max-poly-runs             INTEGER RANGE [x>=1]    Maximum consecutive     β”‚
β”‚                                                     identical nucleotides   β”‚
β”‚                                                     [default: 3]            β”‚
β”‚ --genome-index              PATH                    Genome index for        β”‚
β”‚                                                     off-target analysis     β”‚
β”‚ --snp-file                  PATH                    VCF file with SNPs to   β”‚
β”‚                                                     avoid                   β”‚
β”‚ --skip-structure                                    Skip secondary          β”‚
β”‚                                                     structure prediction    β”‚
β”‚                                                     (faster)                β”‚
β”‚ --skip-off-targets                                  Skip off-target         β”‚
β”‚                                                     analysis (faster)       β”‚
β”‚ --modifications     -m      TEXT                    Chemical modification   β”‚
β”‚                                                     pattern (standard_2ome, β”‚
β”‚                                                     minimal_terminal,       β”‚
β”‚                                                     maximal_stability,      β”‚
β”‚                                                     none)                   β”‚
β”‚                                                     [default:               β”‚
β”‚                                                     standard_2ome]          β”‚
β”‚ --overhang                  TEXT                    Overhang sequence (dTdT β”‚
β”‚                                                     for DNA, UU for RNA)    β”‚
β”‚                                                     [default: dTdT]         β”‚
β”‚ --verbose           -v                              Enable verbose output   β”‚
β”‚ --help                                              Show this message and   β”‚
β”‚                                                     exit.                   β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

Example: Design from Sample Data

β”Œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€ Configuration ───────────────┐
β”‚ 🧬 siRNAforge Toolkit                       β”‚
β”‚ Design Mode: sirna                          β”‚
β”‚ Input: ../examples/sample_transcripts.fasta β”‚
β”‚ Output: /tmp/sirna_example.csv              β”‚
β”‚ Length: 21 nt                               β”‚
β”‚ GC range: 30.0%-60.0%                       β”‚
β”‚ Top candidates: 5                           β”‚
β”‚ Modifications: standard_2ome                β”‚
β”‚ Overhang: dTdT                              β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
2026-01-11 01:22:45,635 - sirnaforge.models.sirna - INFO - siRNA candidates schema validation passed for 2051 candidates
β ‡ Saving results...
                               πŸ“Š Design Summary                               
β”Œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”
β”‚ Metric              β”‚ Value                                                 β”‚
β”œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€
β”‚ Input Sequences     β”‚ 3                                                     β”‚
β”‚ Total Candidates    β”‚ 2051                                                  β”‚
β”‚ Filtered Candidates β”‚ 240                                                   β”‚
β”‚ Top Candidates      β”‚ 5                                                     β”‚
β”‚ Processing Time     β”‚ 2.80s                                                 β”‚
β”‚ Best Score          β”‚ 85.96553642329138                                     β”‚
β”‚ Tool Versions       β”‚ {'python': '3.12.12', 'biopython': '1.86',            β”‚
β”‚                     β”‚ 'sirnaforge': '0.4.1'}                                β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

πŸ† Top Candidates:
β”Œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”
β”‚ ID        β”‚ Transcri… β”‚ Position β”‚ Sequence   β”‚ GC%  β”‚ Hits β”‚ Hit % β”‚ Score β”‚
β”œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”€
β”‚ SIRNAF_N… β”‚ NM_00204… β”‚ 211      β”‚ GTGGAATCA… β”‚ 38.1 β”‚ 1    β”‚ 33.3% β”‚ 86.0  β”‚
β”‚ SIRNAF_N… β”‚ NM_00204… β”‚ 839      β”‚ CACCTTCTT… β”‚ 38.1 β”‚ 1    β”‚ 33.3% β”‚ 86.0  β”‚
β”‚ SIRNAF_N… β”‚ NM_00204… β”‚ 1016     β”‚ GTAGCCAAA… β”‚ 38.1 β”‚ 1    β”‚ 33.3% β”‚ 86.0  β”‚
β”‚ SIRNAF_N… β”‚ NM_00054… β”‚ 198      β”‚ GTAGTTTCC… β”‚ 38.1 β”‚ 1    β”‚ 33.3% β”‚ 86.0  β”‚
β”‚ SIRNAF_N… β”‚ NM_00054… β”‚ 259      β”‚ GACAGCATC… β”‚ 38.1 β”‚ 1    β”‚ 33.3% β”‚ 86.0  β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”˜

βœ… Results saved to: /tmp/sirna_example.csv

Output Preview

id,transcript_id,position,guide_sequence,passenger_sequence,gc_content,asymmetry_score,structure,mfe,paired_fraction,duplex_stability_dg,duplex_stability_score,dg_5p,dg_3p,delta_dg_end,melting_temp_c,off_target_count,guide_pos1_base,pos1_pairing_state,seed_class,supp_13_16_score,seed_7mer_hits,seed_8mer_hits,seed_hits_weighted,off_target_seed_risk_class,transcript_hit_count,transcript_hit_fraction,composite_score,passes_filters,guide_overhang,guide_modifications,passenger_overhang,passenger_modifications,variant_mode,allele_specific,targeted_alleles,overlapped_variants
SIRNAF_NM_002046-7_211_231,NM_002046.7,211,GTGGAATCATATTGGAACATG,CATGTTCCAATATGATTCCAC,38.095238095238095,0.5,.....................,0.0,0.0,-4.099999904632568,0.0,-1.2000000476837158,-1.2000000476837158,0.0,45.19999980926514,0,,,,,,,,,1,0.3333333333333333,85.96553642329138,True,dTdT,2OMe(11),dTdT,2OMe(11),,False,,
SIRNAF_NM_002046-7_839_859,NM_002046.7,839,CACCTTCTTGATGTCATCATA,TATGATGACATCAAGAAGGTG,38.095238095238095,0.5,.....................,0.0,0.0,-12.5,0.21428571428571427,3.700000047683716,3.700000047683716,0.0,62.0,0,,,,,,,,,1,0.3333333333333333,85.96553642329138,True,dTdT,2OMe(11),dTdT,2OMe(11),,False,,
SIRNAF_NM_002046-7_1016_1036,NM_002046.7,1016,GTAGCCAAATTCGTTGTCATA,TATGACAACGAATTTGGCTAC,38.095238095238095,0.5,.....................,0.0,0.0,-2.4000000953674316,0.0,0.6000000238418579,0.6000000238418579,0.0,41.80000019073486,0,,,,,,,,,1,0.3333333333333333,85.96553642329138,True,dTdT,2OMe(11),dTdT,2OMe(11),,False,,
SIRNAF_NM_000546-6_198_218,NM_000546.6,198,GTAGTTTCCATAGGTCTGAAA,TTTCAGACCTATGGAAACTAC,38.095238095238095,0.5,.....................,0.0,0.0,-3.4000000953674316,0.0,0.0,0.0,0.0,43.80000019073486,0,,,,,,,,,1,0.3333333333333333,85.96553642329138,True,dTdT,2OMe(11),dTdT,2OMe(11),,False,,
SIRNAF_NM_000546-6_259_279,NM_000546.6,259,GACAGCATCAAATCATCCATT,AATGGATGATTTGATGCTGTC,38.095238095238095,0.5,.....................,0.0,0.0,-2.299999952316284,0.0,0.800000011920929,0.800000011920929,0.0,41.59999990463257,0,,,,,,,,,1,0.3333333333333333,85.96553642329138,True,dTdT,2OMe(11),dTdT,2OMe(11),,False,,

validate

Check FASTA file format and content.

Help

                                                                               
 Usage: sirnaforge validate [OPTIONS] INPUT_FILE                               
                                                                               
 Validate a FASTA file and report basic statistics.                            
                                                                               
 This performs lightweight validation (parseable FASTA, presence of            
 sequences, and common issues like short/ambiguous sequences).                 
                                                                               
β”Œβ”€ Arguments ─────────────────────────────────────────────────────────────────┐
β”‚ *    input_file      FILE  FASTA file to validate [required]                β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
β”Œβ”€ Options ───────────────────────────────────────────────────────────────────┐
β”‚ --help          Show this message and exit.                                 β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

Example: Validate Sample Data

        πŸ“‹ FASTA Validation Results         
β”Œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”¬β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”
β”‚ Metric                       β”‚ Value     β”‚
β”œβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”Όβ”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€
β”‚ Total sequences              β”‚ 3         β”‚
β”‚ Total length                 β”‚ 5,117 nt  β”‚
β”‚ Average length               β”‚ 1705.7 nt β”‚
β”‚ Min length                   β”‚ 1285 nt   β”‚
β”‚ Max length                   β”‚ 2512 nt   β”‚
β”‚ Short sequences (<50 nt)     β”‚ 0         β”‚
β”‚ Ambiguous sequences (with N) β”‚ 0         β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”΄β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
βœ… FASTA validation complete

config

Show default configuration parameters.

Default Design Parameters:

Basic Parameters:
  siRNA length: 21 nt
  Top candidates: 500

Filtering Criteria:
  GC content: 35.0% - 60.0%
  Max poly runs: 3
  Max paired fraction: 0.6

Scoring Weights:
  Asymmetry: 0.15
  GC content: 0.15
  Accessibility: 0.2
  Off-target: 0.3
  Empirical: 0.2

sequences

Manage siRNA sequences and chemical modification metadata.

Help

                                                                               
 Usage: sirnaforge sequences [OPTIONS] COMMAND [ARGS]...                       
                                                                               
 Manage siRNA sequences and metadata                                           
                                                                               
β”Œβ”€ Options ───────────────────────────────────────────────────────────────────┐
β”‚ --help          Show this message and exit.                                 β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜
β”Œβ”€ Commands ──────────────────────────────────────────────────────────────────┐
β”‚ show       Show sequences from a FASTA file in table, JSON, or FASTA        β”‚
β”‚            format.                                                          β”‚
β”‚ annotate   Merge metadata from a JSON file into FASTA headers.              β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜

cache

Manage miRNA database cache for off-target analysis.

Help

                                                                               
 Usage: sirnaforge cache [OPTIONS]                                             
                                                                               
 Inspect and clear the unified reference cache.                                
                                                                               
 This command can display cache statistics and/or delete cached assets for     
 miRNA databases and transcriptomes.                                           
                                                                               
β”Œβ”€ Options ───────────────────────────────────────────────────────────────────┐
β”‚ --clear                        Clear all cached databases (miRNA +          β”‚
β”‚                                transcriptomes)                              β”‚
β”‚ --clear-mirna                  Clear only miRNA databases                   β”‚
β”‚ --clear-transcriptome          Clear only transcriptomes                    β”‚
β”‚ --dry-run                      Show what would be deleted without actually  β”‚
β”‚                                deleting                                     β”‚
β”‚ --info                         Show cache information for all databases     β”‚
β”‚ --help                         Show this message and exit.                  β”‚
β””β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”€β”˜