Chemical Modification Patterns Reference
Comprehensive guide to chemical modification patterns for siRNA stability, delivery, and therapeutic applications.
Overview
Chemical modifications enhance siRNA stability and reduce off-target effects while maintaining on-target potency. This guide covers built-in patterns, FDA-approved examples, and best practices for custom pattern design.
Built-In Modification Patterns
Standard 2’-O-Methyl (Recommended)
File: examples/modification_patterns/standard_2ome.json
Strategy:
Guide strand: Alternating 2’-O-methyl at odd positions (1, 3, 5, 7, 9, 11, 13, 15, 17, 19)
Passenger strand: Offset alternating at even positions (2, 4, 6, 8, 10, 12, 14, 16, 18, 20)
Overhang: dTdT (DNA) on both 3’ ends
Properties:
Serum stability: ~24 hours
Synthesis cost: 1.5× unmodified
Nuclease resistance: Moderate-high
RISC loading: High efficiency
Best For:
General research applications
In vitro efficacy studies
Initial in vivo feasibility
Industry-standard baseline
Example:
sirnaforge workflow TP53 \
--modifications standard_2ome \
--output-dir tp53_standard
Minimal Terminal (Cost-Optimized)
File: examples/modification_patterns/minimal_terminal.json
Strategy:
Guide strand: 3’ terminal only (19, 20, 21)
Passenger strand: 5’ terminal only (1, 2)
Overhang: dTdT (DNA)
Properties:
Serum stability: ~6 hours
Synthesis cost: 1.1× unmodified
Nuclease resistance: Low-moderate
RISC loading: High efficiency
Best For:
High-throughput screening
Cost-sensitive experiments
In vitro only (cell culture with serum-free media)
Transient knockdown studies
Limitations:
Not suitable for in vivo work
Requires frequent media changes
Limited serum stability
Example:
sirnaforge design input.fasta \
--modifications minimal_terminal \
--output minimal_cost.csv
Maximal Stability (Therapeutic-Grade)
File: examples/modification_patterns/maximal_stability.json
Strategy:
Guide strand: Complete 2’-O-methyl at all positions (1-21) + PS linkages at terminal dinucleotides
Passenger strand: Complete 2’-O-methyl (1-21) + 5’ PS linkages
Overhang: dTdT with optional PS modifications
Properties:
Serum stability: ~72 hours
Synthesis cost: 3.0× unmodified
Nuclease resistance: Very high
RISC loading: High efficiency
Best For:
In vivo efficacy studies
Therapeutic development programs
Preclinical toxicology
Long-term knockdown experiments
Requirements:
Specialized delivery (LNP or GalNAc conjugates)
HPLC purification recommended
Extended synthesis time (2-4 weeks)
Example:
sirnaforge workflow TTR \
--modifications maximal_stability \
--species human \
--output-dir ttr_therapeutic
FDA-Approved References:
Patisiran (Onpattro) - TTR, 2018, hATTR amyloidosis
Givosiran (Givlaari) - ALAS1, 2019, Acute hepatic porphyria
FDA-Approved Example: Patisiran (Onpattro)
File: examples/modification_patterns/fda_approved_onpattro.json
First FDA-approved RNAi therapeutic (2018) targeting transthyretin (TTR) for hereditary transthyretin-mediated amyloidosis.
Guide Strand (Patisiran)
Sequence: AUGGAAUACUCUUGGUUAC
Modifications:
2’-O-methyl at positions: 1, 4, 6, 11, 13, 16, 19
Overhang: dTdT
Strategic pattern optimized for stability + RISC loading
Rationale:
Balances nuclease resistance with guide strand activity
Maintains A/U-rich 5’ seed region accessibility
7 modifications provide excellent stability without over-modification
Passenger Strand (Patisiran)
Sequence: GUAACCAAGAGUAUUCCAU
Modifications:
2’-O-methyl at positions: 3, 8, 10, 15
Overhang: dTdT
Limited modifications to promote degradation
Rationale:
Fewer modifications than guide (intentional)
Promotes preferential RISC loading of guide strand
Reduces passenger strand activity/off-targets
Clinical Success
Efficacy:
Significant TTR reduction in Phase III trials (80% knockdown)
FDA approved August 2018
First-in-class RNAi therapeutic
Delivery:
Lipid nanoparticle (LNP) formulation
IV infusion: 0.3 mg/kg every 3 weeks
Hepatocyte-targeted delivery
Use This Pattern For:
Liver-targeted therapeutic development
Benchmarking modification strategies
Regulatory submission templates
Educational/training purposes
Example:
The Patisiran regimen is provided as a reference exemplar in
examples/modification_patterns/fda_approved_onpattro.json, not as a built-in
--modifications generator pattern. The --modifications flag only accepts the
built-in patterns (standard_2ome, minimal_terminal, maximal_stability, none).
To design TTR-targeting candidates with a built-in pattern and then compare against
the FDA reference:
# Design TTR-targeting siRNA with a built-in modification pattern
sirnaforge workflow TTR \
--modifications standard_2ome \
--species human \
--output-dir ttr_patisiran_template
# Reference Patisiran (Onpattro) modification layout for comparison:
# examples/modification_patterns/fda_approved_onpattro.json
References: TODO: Review
Adams et al. (2018) NEJM 379:11-21. PMID: 30145929
US Patent US10060921B2
FDA Drug Approval Package (2018)
Modification Types Reference
2’-O-Methyl (2OMe)
Most Common Choice
Chemistry: Methyl group at 2’ position of ribose
Stability gain: ++ (good)
Cost factor: 1.2-1.5× per modification
RISC compatibility: Excellent
Typical positions: Alternating or custom patterns
Pros:
Industry standard
Well-characterized
Compatible with all synthesis platforms
Maintains Watson-Crick pairing
Cons:
Moderate cost increase
May require 10+ modifications for therapeutic stability
Phosphorothioate (PS)
Internucleotide Linkages
Chemistry: Sulfur replaces non-bridging oxygen in phosphate backbone
Stability gain: +++ (very good)
Cost factor: 1.3-1.8× per linkage
Typical positions: Terminal dinucleotides (5’ and 3’)
Pros:
Excellent nuclease resistance
Enhances protein binding (albumin)
Can improve pharmacokinetics
Cons:
Potential for non-specific binding
Synthesis complexity increases
Can affect duplex stability
Best Practice:
Limit to 2-4 linkages per strand
Focus on terminal positions
Often combined with 2’-O-methyl
2’-Fluoro (2F)
Pyrimidine-Specific
Chemistry: Fluorine at 2’ position (C and U only)
Stability gain: +++ (very good)
Cost factor: 1.5-2.0×
Typical positions: All pyrimidines
Pros:
Superior nuclease resistance vs 2OMe
Maintains duplex stability
Good RISC compatibility
Cons:
Higher synthesis cost
Pyrimidine-restricted (can’t modify A/G)
Less commonly used than 2OMe
Locked Nucleic Acid (LNA)
High-Affinity Modifications
Chemistry: Methylene bridge locks ribose in C3’-endo conformation
Stability gain: ++++ (excellent)
Cost factor: 2-3× per residue
Typical positions: Sparse (every 3-4 nt)
Pros:
Extremely high binding affinity
Superior nuclease resistance
Very effective at low frequency
Cons:
Expensive
Can inhibit RISC loading if over-used
Requires careful positioning
Not all synthesis providers offer
Best Practice:
Use sparingly (2-3 per strand maximum)
Avoid seed region (positions 2-8)
Often combined with 2’-O-methyl
2’-O-Methoxyethyl (MOE)
Alternative to 2OMe
Chemistry: Methoxyethyl group at 2’ position
Stability gain: ++ (good)
Cost factor: 1.5-2.0×
Pros:
Good nuclease resistance
Reduced immunogenicity vs 2OMe
Used in some antisense applications
Cons:
Less common than 2OMe for siRNA
Higher cost
Limited track record in approved therapeutics
Custom Pattern Design
Design Principles
1. Start Conservative
Begin with standard patterns
Add modifications incrementally
Test efficacy at each step
2. Balance Competing Goals
Stability ↔ Cost
Nuclease resistance ↔ RISC loading
On-target potency ↔ Off-target reduction
3. Consider Application
In vitro: Minimal modifications sufficient
In vivo (research): Standard patterns
Therapeutic: Maximal stability required
4. Strand Asymmetry
More modifications on guide strand
Fewer modifications on passenger strand
Promotes guide strand RISC loading
Pattern Template
Create custom JSON files following this structure:
{
"pattern_name": "my_custom_pattern",
"description": "Brief description of strategy",
"reference": "Literature or internal study reference",
"guide_modifications": {
"2OMe": {
"positions": [1, 3, 5, 7, 9],
"strategy": "alternating",
"rationale": "Why these positions?"
},
"PS": {
"positions": [],
"internucleotide_linkages": [
[1, 2],
[20, 21]
],
"rationale": "Terminal linkages for stability"
}
},
"passenger_modifications": {
"2OMe": {
"positions": [2, 4, 6],
"strategy": "sparse",
"rationale": "Minimal to promote degradation"
}
},
"overhang": {
"guide_3prime": "dTdT",
"passenger_3prime": "dTdT",
"rationale": "Standard DNA overhangs"
},
"estimated_properties": {
"serum_stability_half_life_hours": 24,
"relative_synthesis_cost": 1.5,
"nuclease_resistance": "moderate-high",
"risc_loading_efficiency": "high",
"recommended_for": "in_vitro, initial_in_vivo"
},
"notes": [
"Additional context",
"Testing recommendations",
"Known limitations"
]
}
Position Selection Strategies
Alternating (Balanced)
Guide: [1, 3, 5, 7, 9, 11, 13, 15, 17, 19]
Passenger: [2, 4, 6, 8, 10, 12, 14, 16, 18, 20]
Standard industry approach
Good stability/cost balance
Maintains duplex structure
Terminal-Heavy (Cost-Optimized)
Guide: [1, 2, 19, 20, 21]
Passenger: [1, 2]
Minimal synthesis cost
Protects most vulnerable positions
Suitable for in vitro only
Seed-Region Preservation
Guide: [1, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19]
Passenger: [full complement]
Avoids positions 2-8 (seed region)
May improve target recognition
Based on some miRNA-mimetic designs
Complete (Therapeutic)
Guide: [1-21] all positions
Passenger: [1-21] all positions
+ PS linkages at terminals
Maximum stability
Therapeutic-grade
Highest cost
Application-Specific Recommendations
In Vitro Screening (96-well, 384-well)
Recommended Pattern: Minimal Terminal
Rationale:
Cost is primary concern
Short exposure time (<72 hours)
Serum-free or low-serum media
High-throughput compatible
Example:
sirnaforge design library.fasta \
--modifications minimal_terminal \
--top-n 500 \
--output hts_library.csv
In Vitro Validation Studies
Recommended Pattern: Standard 2’-O-Methyl
Rationale:
Industry standard for publications
Good stability in culture media
Reproducible results
Comparable to literature
Example:
sirnaforge workflow GENE \
--modifications standard_2ome \
--top-n 20
In Vivo Proof-of-Concept
Recommended Pattern: Standard or Maximal Stability
Rationale:
Need extended half-life
Systemic delivery challenges
Nuclease-rich environment
Justifies higher cost
Example:
sirnaforge workflow TARGET \
--modifications maximal_stability \
--species mouse \
--output-dir invivo_poc
Therapeutic Development
Recommended Pattern: Maximal Stability (Custom Optimized)
Rationale:
Regulatory requirements
Long-term efficacy needed
Safety/tox studies
Cost justified by value
Requirements:
GMP-grade synthesis
HPLC purification
Mass spec confirmation
Batch-to-batch QC
Consider:
GalNAc conjugation for hepatocytes
Lipid nanoparticle formulation
Antibody conjugates for targeting
Patent landscape review
Synthesis and Ordering
Synthesis Vendors
Major Providers:
Integrated DNA Technologies (IDT)
Thermo Fisher (Dharmacon)
Sigma-Aldrich
GenePharma
TriLink BioTechnologies
Cost Estimates (2025)
Base siRNA (21bp duplex, unmodified): ~$200-400
Modifications (per strand):
2’-O-methyl: +$20-50 per modification
Phosphorothioate: +$30-80 per linkage
2’-Fluoro: +$40-100 per modification
LNA: +$100-200 per residue
Additional Costs:
HPLC purification: +$100-300
Mass spec QC: +$50-150
Bulk synthesis (5+ sequences): -30-50% discount
GMP-grade: 2-5× standard pricing
Pattern Cost Examples:
Minimal terminal: ~$250-450
Standard 2OMe: ~$400-600
Maximal stability: ~$800-1,200
Therapeutic + conjugate: $2,000-5,000+
Ordering Checklist
Required Information:
✅ Sequences (guide + passenger)
✅ Modification map (positions + types)
✅ Overhang specification
✅ Purification method (HPLC recommended)
✅ Scale (nmol) - typically 100-200 nmol research scale
✅ QC requirements (mass spec, HPLC traces)
Recommended Documentation:
Provide modification JSON file
Include synthesis notes from vendor
Archive lot numbers and QC data
Store at -20°C or -80°C
Timeline Expectations
Unmodified: 5-10 business days
Standard modifications: 2-3 weeks
Extensive modifications: 3-4 weeks
GMP/therapeutic grade: 6-12 weeks
Custom conjugates: 4-8 weeks
Best Practices
1. Design Before You Modify
✅ Do: Design unmodified siRNAs first, validate efficacy, then apply modifications
❌ Don’t: Start with heavily modified sequences without unmodified baseline
2. Test Incrementally
✅ Do: Compare minimal → standard → maximal patterns
❌ Don’t: Jump to maximal modifications without intermediate validation
3. Document Everything
✅ Do: Record modification patterns, lot numbers, QC data, storage conditions
❌ Don’t: Rely on memory or informal notes
4. Match Pattern to Application
✅ Do: Use minimal for screening, standard for validation, maximal for in vivo
❌ Don’t: Over-spend on stability you don’t need
5. Consider Delivery Method
✅ Do: Design modifications compatible with your delivery system (LNP, electroporation, etc.)
❌ Don’t: Ignore how modifications affect delivery vehicle interactions
6. Archive Modification Files
✅ Do: Version control JSON files with sequences
❌ Don’t: Recreate modification schemes from memory
Integration with siRNAforge
Command-Line Usage
# Apply pattern during design
sirnaforge design input.fasta \
--modifications standard_2ome \
--output designed.csv
# Apply pattern during workflow
sirnaforge workflow GENE \
--modifications standard_2ome \
--output-dir results
Python API
from sirnaforge.modifications import load_metadata, save_metadata_json
from sirnaforge.models.modifications import StrandMetadata, ChemicalModification
# Load built-in pattern
pattern = load_metadata("examples/modification_patterns/standard_2ome.json")
# Create custom metadata
metadata = StrandMetadata(
id="custom_sirna_001",
sequence="AUCGAUCGAUCGAUCGAUCGA",
overhang="dTdT",
chem_mods=[
ChemicalModification(type="2OMe", positions=[1, 3, 5, 7, 9])
]
)
# Save for later use
save_metadata_json({"custom_sirna_001": metadata}, "my_mods.json")
Annotate Existing FASTA
# Merge modification metadata into FASTA headers
sirnaforge sequences annotate \
candidates.fasta \
modifications.json \
-o candidates_annotated.fasta
Troubleshooting
Low Efficacy After Modification
Possible Causes:
Over-modification in seed region (positions 2-8)
Excessive passenger modifications reducing RISC loading
Delivery method incompatibility
Solutions:
Reduce modifications in seed region
Ensure guide strand preference (asymmetric modification)
Test unmodified sequence as control
High Cost Synthesis
Possible Causes:
Too many modifications
Exotic modification types (LNA, custom)
Small scale orders
Solutions:
Use minimal or standard patterns
Order multiple sequences together (bulk discount)
Request quotes from multiple vendors
Inconsistent Results
Possible Causes:
Vendor variability
Storage degradation
Batch differences
Solutions:
Specify HPLC purification
Request lot-to-lot QC data
Store properly (-20°C or -80°C)
Use consistent vendor/synthesis method
References
Key Publications
Alnylam Platform Papers
Foster et al. (2018) “Advanced siRNA designs further improve in vivo performance” - Mol Ther 26:708-717
FDA-Approved Therapeutics
Adams et al. (2018) “Patisiran, an RNAi therapeutic…” - NEJM 379:11-21
Balwani et al. (2020) “Givosiran for acute hepatic porphyria” - NEJM 382:2289-2301
Modification Chemistry
Deleavey & Damha (2012) “Designing chemically modified oligonucleotides” - Chem Biol 19:937-954
Design Principles
Khvorova & Watts (2017) “The chemical evolution of oligonucleotide therapies” - Nat Biotechnol 35:238-248
Regulatory Guidance
FDA Guidance for Industry: siRNA-Based Therapeutics (2020)
EMA Guideline on Quality of Oligonucleotide-Based Medicinal Products (2021)
Patents
US10060921B2: Patisiran (Onpattro) - Alnylam
US9605264B2: RNAi modifications - Alnylam
Multiple patents covering specific modification patterns
Contributing Patterns
To contribute new patterns to siRNAforge:
Create JSON File: Follow the template structure
Validate Format: Test with siRNAforge tools
Document Rationale: Include references and use cases
Add Examples: Provide working command-line examples
Submit PR: Via GitHub with detailed description
Example Contribution:
# Test your pattern
sirnaforge design test.fasta \
--modifications standard_2ome \
--output test_output.csv
# Verify it works
cat test_output.csv | head -10
Document Version: 1.0 Last Updated: December 2025 Maintainer: siRNAforge Team
For questions or contributions, see GitHub repository.